View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12835_high_20 (Length: 258)
Name: NF12835_high_20
Description: NF12835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12835_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 26642483 - 26642255
Alignment:
| Q |
1 |
ctctagatctccaacaagagcgaaagcgcggacgaagaaatcgagaacgatgagcttattgtggacggattctgcagtgatggattgaatgatggaaaga |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26642483 |
ctctagatctccaacaatagcgaaagcgcagacgaagaaatcgagaacgatgagcttattgtggacggattctgcagtgatggattgaatgatggaaaga |
26642384 |
T |
 |
| Q |
101 |
gattcagatttgaggagttgattcaagctggatcgaatttcaactaacgatttcacgtctttggaaaccaagagcgaatctagaaatcggagcgtggaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26642383 |
gattcagatttgaggagttgattcaagctggatcgaatttcaactaacgatttcacgtctttggaaaccaagagcgaatctagaaatcggagcgtggaat |
26642284 |
T |
 |
| Q |
201 |
cgccgaaactgcgatgaaatcaaaatgtt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26642283 |
cgccgaaactgcgatgaaatcaaaatgtt |
26642255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 26655923 - 26655695
Alignment:
| Q |
1 |
ctctagatctccaacaagagcgaaagcgcggacgaagaaatcgagaacgatgagcttattgtggacggattctgcagtgatggattgaatgatggaaaga |
100 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||| ||||||| ||| | | |||||| |||||||| |||||||| || || |
|
|
| T |
26655923 |
ctctagatctccgacgagagcgaaagcgcggacgaagaaatcgagaacgagaagcttatcgtgaattgtttctgcggtgatggaatgaatgatagatagt |
26655824 |
T |
 |
| Q |
101 |
gattcagatttgaggagttgattcaagctggatcgaatttcaactaacgatttcacgtctttggaaaccaagagcgaatctagaaatcggagcgtggaat |
200 |
Q |
| |
|
||||| |||||||||||||| |||| |||||||||||||| ||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
26655823 |
gattcggatttgaggagttgcgtcaaactggatcgaatttcgactaacgatttcacgtctttggagatcaaaagcgaatctagaaatcggagcgtggaat |
26655724 |
T |
 |
| Q |
201 |
cgccgaaactgcgatgaaatcaaaatgtt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26655723 |
cgccgaaactgcgatgaaatcaaaatgtt |
26655695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University