View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12835_high_23 (Length: 238)
Name: NF12835_high_23
Description: NF12835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12835_high_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 35338782 - 35338559
Alignment:
| Q |
15 |
ataaagaagctaatatcaaacagtcacaacaacagcattgatctaaatagctgtttccgtgccgaaatctcaactttgggaaaaataaggcatagaaaca |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35338782 |
ataaagaagctaacatcaaacagtcacaacaacagcattgatctaaatagctgtttccgtgccgaaatctcaactttgggaaaaataaggcataaaaaca |
35338683 |
T |
 |
| Q |
115 |
ttgtgaagttatatggtttctgcaaccatagtggctcaagtatgctattttatgagtacatggaaaagggtagtttgggagagttacttcatggagaatc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35338682 |
ttgtgaagttatatggtttctgcaaccatagtggctcaagtatgctattttatgagtacatggaaaagggtagtttgggagagttacttcatggagaatc |
35338583 |
T |
 |
| Q |
215 |
ttcctctagtctagattggtattc |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35338582 |
ttcctctagtctagattggtattc |
35338559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University