View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12835_high_24 (Length: 236)
Name: NF12835_high_24
Description: NF12835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12835_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 12030495 - 12030294
Alignment:
| Q |
19 |
attgcagattttcttgtctcaaattccaaactttcatgaattgacatggatttcaactgttgctgcaattacctcgtttggttatgtattcattgcaatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12030495 |
attgcagattttcttgtctcaaattccaaactttcatgaattgacatggatttcaaccgttgctgcaattacctcgtttggttatgtattcattgcaatt |
12030396 |
T |
 |
| Q |
119 |
gctctttgttttaacgttatcatctcaggtacgtagttttcaccattagtttaaactttaaagtttcgtatctaaccaagtaggcattttggctaagaac |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12030395 |
gctctttgttttaacgttattatctcaggtacgtagttttcaccattagtttaaagtttaaagtttcgtatctaaccaagtaggcattttggctaagaac |
12030296 |
T |
 |
| Q |
219 |
ag |
220 |
Q |
| |
|
|| |
|
|
| T |
12030295 |
ag |
12030294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 127
Target Start/End: Original strand, 242698 - 242806
Alignment:
| Q |
19 |
attgcagattttcttgtctcaaattccaaactttcatgaattgacatggatttcaactgttgctgcaattacctcgtttggttatgtattcattgcaatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| || |||||||||| ||||| |||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
242698 |
attgcagattttcttgtctcaaattcccaactttcacaaactgacatggatctcaaccattgccgctatcacctcgtttggttatgtattcattgcaatt |
242797 |
T |
 |
| Q |
119 |
gctctttgt |
127 |
Q |
| |
|
| ||||||| |
|
|
| T |
242798 |
ggtctttgt |
242806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 222694 - 222598
Alignment:
| Q |
19 |
attgcagattttcttgtctcaaattccaaactttcatgaattgacatggatttcaactgttgctgcaattacctcgtttggttatgtattcattgca |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| || |||||||||| ||||| |||| || || ||||||||||||||||||||||||||| |
|
|
| T |
222694 |
attgcagattttcttgtctcaaattcccaactttcacaaactgacatggatatcaaccattgccgctatcacctcgtttggttatgtattcattgca |
222598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 23 - 113
Target Start/End: Original strand, 51529364 - 51529454
Alignment:
| Q |
23 |
cagattttcttgtctcaaattccaaactttcatgaattgacatggatttcaactgttgctgcaattacctcgtttggttatgtattcattg |
113 |
Q |
| |
|
|||||||| ||||||||||| ||||| || ||| | || |||| ||| |||||||||||||| |||||||| |||||||||| ||| |||| |
|
|
| T |
51529364 |
cagattttattgtctcaaatcccaaatttccataagttaacattgatatcaactgttgctgctattacctcttttggttatgcattaattg |
51529454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University