View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12835_low_10 (Length: 351)
Name: NF12835_low_10
Description: NF12835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12835_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 20 - 340
Target Start/End: Complemental strand, 32582018 - 32581698
Alignment:
| Q |
20 |
ccgagctcttctctataaataccattttccaacacatcactcatacaatcaattttgagaacttctcttcttcaactactctcatatctttctctgagtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582018 |
ccgagctcttctctataaataccattttccaacacatcactcatacaatcaattttgagaacttctcttcttcaactactctcatatctttctctgagtg |
32581919 |
T |
 |
| Q |
120 |
atattgaaaaaagaacaatggcaaattctttgagctttctcatgcttctttctttactagcatttgctcctttttgcctctgtcataagaaaatggggtc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32581918 |
atattgaaaaaagaacaatggcaaattctttgagctttctcatgcttctttctttactagcatttgctcctttttgcctctgtcataagaaaatggggtc |
32581819 |
T |
 |
| Q |
220 |
ttacctttatccacaattttatgactattcatgtccacaagctcagaatattgttaagtccatccttgccaatgctgttgcaaaggaacctcgtatagct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32581818 |
ttacctttatccacaattttatgactattcatgtccacaagctcagaatattgttaagtccatccttgccaatgctgttgcaaaggaaccccgtatagct |
32581719 |
T |
 |
| Q |
320 |
gcttcacttttgagacttcat |
340 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32581718 |
gcttcacttttgagacttcat |
32581698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University