View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12835_low_12 (Length: 323)
Name: NF12835_low_12
Description: NF12835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12835_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 19 - 312
Target Start/End: Complemental strand, 31465265 - 31464972
Alignment:
| Q |
19 |
cgaagaaggagcctgtgagctgcaactacgggatgttgatcggagacaaagagaatgatcgaaaaaatgttgttttgcttagaaatgaggacagcgacac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31465265 |
cgaagaaggagcctgtgagctgcaactatgggatgttgatcggagacaaagagaatgatcgaaaaaatgttgttttgcttagaaatgaggacaatgacac |
31465166 |
T |
 |
| Q |
119 |
atcctcatcagtgatcaccgatgagaataattatggtaacaacgttggtgaaaatcaagttaactcgtgtttcattccatcagatacattgatgttggag |
218 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465165 |
atcctcatcggtgatcaccgatgagaataattatggtaacaacgtcggtgaaaatcaggttaactcgtgtttcattccatcagatacattgatgttggag |
31465066 |
T |
 |
| Q |
219 |
cctccgttgaacccttacatgacaaacttcttggcgtcgagctcagccgagttcatgtgctcaagtcagcccttattgaactactcagattcat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465065 |
cctccgttgaacccttacatgacaaacttcttggcgtcgagctcagccgagttcatgtgctcaagtcagcccttattgaactactcagattcat |
31464972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University