View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12835_low_13 (Length: 318)
Name: NF12835_low_13
Description: NF12835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12835_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 24 - 301
Target Start/End: Original strand, 698311 - 698589
Alignment:
| Q |
24 |
ataaaattgagcctatggccgagttattggaacctaaaccagagattggaaccttggtaaacttatctgactgatctgttttttgttttcctatgctttt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
698311 |
ataaaattgagcctatggccgagttattggaacctaaaccagagattgggaccttggtaaacttagctgactgatctgttttttgttttcctatgctttt |
698410 |
T |
 |
| Q |
124 |
gatcattgagcttagagctttggatagtgtgctttcttgtggagtttttggtggccggcgattaatgactgacttcagagg-aatattataggctttggt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
698411 |
gatcattgagcttagagctttggatagtgtgctttcttgtggagtttttggtggccggcaatcaatgactgacttcagaggaaatattataggctttggt |
698510 |
T |
 |
| Q |
223 |
tttctttcctttttatgaactaataggctttggttactgccatgggttaactgatgttgtgtatatatcttttccagtg |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
698511 |
tttctttcctttttatgaactaataggctttggttactgccatgggttaactgatgttgtgtatatatcttttccagtg |
698589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 104 - 158
Target Start/End: Original strand, 665591 - 665644
Alignment:
| Q |
104 |
ttttgttttcctatgcttttgatcattgagcttagagctttggatagtgtgcttt |
158 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
665591 |
ttttgttttc-tatgcttttgttcattgagcttagagctttggatagtgtgcttt |
665644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University