View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12835_low_14 (Length: 314)
Name: NF12835_low_14
Description: NF12835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12835_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 26203855 - 26203559
Alignment:
| Q |
1 |
ggttgggtgcgtgtgggtcccacttaatctctttcttaaccccc-actttccattttatagactcaccacatcaccgacgcataccaaacactcaaatnn |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26203855 |
ggttgggtgcgtgtgggtcccacttaatctctttcttaaccccccactttccattttatacactcaccacatcaccgacgcataccaagcactcaaataa |
26203756 |
T |
 |
| Q |
100 |
nnnnntcaattcaactccaactaactccaccagccaccaccatgacgacggcgatctcggtggcggaacccgaactgaaaacatactggtgccacgaatg |
199 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26203755 |
aaaaatcaattcaactc-aactaactccaccagccaccaccatgacgacggcgatctcggtggcggaacccgaactgaaaacatactggtgccacgaatg |
26203657 |
T |
 |
| Q |
200 |
tgacatgagcgtttctttaactacttctcacaccccctctcctctactctgtccccattgcgacactcatttcctcgaactcatggactcaccttttt |
297 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26203656 |
tgacatgagtgtttctttaactacttctctcaccccctctcctctactctgtccccattgcgacactcatttcctcgaactcatggactcaccttttt |
26203559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University