View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12835_low_26 (Length: 234)
Name: NF12835_low_26
Description: NF12835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12835_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 218
Target Start/End: Complemental strand, 33228955 - 33228745
Alignment:
| Q |
8 |
ggagcagagaaggaaagtattagaaaatgggtttgaaacataaatggtggttctgtttcaatatgtaacagtgtgcatcgagtagtaactcccaaacttc |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
33228955 |
ggagtagagaaggaaagtattagaaaatgggtttgaaacataaatggtggttctgtttcaatatgtatcagtgtgcatcgagtagtaactcccgaacttc |
33228856 |
T |
 |
| Q |
108 |
agcaatcgagagttaactcatgaaccgtttgaaagttacgaaccgagagaggtatttttggtagtttgaggggcctatgagcagtggaatgggcctgatg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33228855 |
agcaatcgagagttaactcatgaaccgtttgaaagttacgaaccgagagaggtatttttggtagtttgaggggcctatgagcaatggaatgggcctgatg |
33228756 |
T |
 |
| Q |
208 |
agtaatttcct |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
33228755 |
agtaatttcct |
33228745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University