View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12836_high_14 (Length: 244)
Name: NF12836_high_14
Description: NF12836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12836_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 44958936 - 44958698
Alignment:
| Q |
1 |
ttgatcattctgattctactaaatgtgtgacatgaatcaggaggtttactgcatcaatgattaagatttagtaaaagaaagatgggatnnnnnnn--taa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44958936 |
ttgatcattctgattctactaaatgtgtgacatgaatcaggaggtttactgcatcaatgattaagatttagtaaaagaaagatgggatgggggggggtaa |
44958837 |
T |
|
| Q |
99 |
tatggaatagtacgtaagtggggtctaagaccttatcggtttccaggtgttggctcaggtggtggggtatagctgctggttattgcccaaaccaatgtac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44958836 |
tatggaatagtacgtaagtggggtctaagaccttatcggtttccaggtgttggctcaggtggtggggtatagctgctggttattgcccaaaccaatgtac |
44958737 |
T |
|
| Q |
199 |
aatgtcactgacaaacaggtggatcattccccatcttct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44958736 |
aatgtcactgacaaacaggtggatcattccccatcttct |
44958698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University