View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12836_low_11 (Length: 287)
Name: NF12836_low_11
Description: NF12836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12836_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 269
Target Start/End: Complemental strand, 32286735 - 32286481
Alignment:
| Q |
17 |
acatcatttgggcacttgttcataaaaagtgacacgacaccnnnnnnncttcatagagttaacatcttaggcggaaacgactaactgaacgaatatacta |
116 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32286735 |
acatcatttgggcacttgtccataaaaagtgacacgacacctttttttcttcatagagttaacatcttaggcggaaacgactaactgaacgaatatacta |
32286636 |
T |
|
| Q |
117 |
ggattattttgcgttttcatgtgtgtt--ggactatgatgacaaccagacacttttaagaaccaaaatggtagtttgtcacttttttcagttgagagaat |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32286635 |
ggattattttgcgttttcatgtgtgttatggactatgatgacaaccagacacttttaagaaccaaaatggtagtttgtcacttttttcaattgagagaat |
32286536 |
T |
|
| Q |
215 |
ccactccctcttccaccacaccacactgtatatcattcatggtctccaacaacca |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32286535 |
ccactccctcttccaccacaccacactgtatatcattcatggtctccaacaacca |
32286481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University