View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12836_low_12 (Length: 271)
Name: NF12836_low_12
Description: NF12836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12836_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 26196114 - 26196352
Alignment:
| Q |
1 |
catcccatgtttggactatccctaaaatccaagatagtgggatgttccaaaatcaagatcgaaatggctcaagaaagatgatgctaacacacaaaaatcc |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26196114 |
catcccatgtttggactctccctaaaatccaagatagtgggatgttccaaaatcaagatcgaaatggctcaaaaaagatgatgctaacacacaaaaatcc |
26196213 |
T |
 |
| Q |
101 |
atgcttgtgttaattgtagaaagagagcaaatgcaactgtgggacttaaaagacttaaaaagggggagaagtggttggagggtttggtagaggtgcagaa |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26196214 |
atgcttgtgttaatagtagaaagagagcaaatgcaactgtgg---------gacttaaaaaaggggagaagtggttggagggtttggtagaggtgcagaa |
26196304 |
T |
 |
| Q |
201 |
ggagatatttagctattttgcaaatcactttgaaaatgttggttggaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26196305 |
ggagatatttagctattttgcaaatcactttgaaaatgttggttggaa |
26196352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University