View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12836_low_15 (Length: 244)

Name: NF12836_low_15
Description: NF12836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12836_low_15
NF12836_low_15
[»] chr4 (1 HSPs)
chr4 (1-237)||(44958698-44958936)


Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 44958936 - 44958698
Alignment:
1 ttgatcattctgattctactaaatgtgtgacatgaatcaggaggtttactgcatcaatgattaagatttagtaaaagaaagatgggatnnnnnnn--taa 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||    
44958936 ttgatcattctgattctactaaatgtgtgacatgaatcaggaggtttactgcatcaatgattaagatttagtaaaagaaagatgggatgggggggggtaa 44958837  T
99 tatggaatagtacgtaagtggggtctaagaccttatcggtttccaggtgttggctcaggtggtggggtatagctgctggttattgcccaaaccaatgtac 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44958836 tatggaatagtacgtaagtggggtctaagaccttatcggtttccaggtgttggctcaggtggtggggtatagctgctggttattgcccaaaccaatgtac 44958737  T
199 aatgtcactgacaaacaggtggatcattccccatcttct 237  Q
    |||||||||||||||||||||||||||||||||||||||    
44958736 aatgtcactgacaaacaggtggatcattccccatcttct 44958698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University