View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12836_low_18 (Length: 219)
Name: NF12836_low_18
Description: NF12836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12836_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 470592 - 470410
Alignment:
| Q |
14 |
agagagagagaagcaaatattattgagattaccaacatgggttagtctactttccatatgtttacaagacgtaatccatgtgcccatgattactcaacaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
470592 |
agagagagagaagcaaatattattgagattaccaacatgggttagtctactttccatatgtttgcaagacgtaatccatgtgcccatgattactcaacaa |
470493 |
T |
|
| Q |
114 |
gcttttcnnnnnnnnaatcaactaccccatttttagaggatcaaaattaatttagaaaacccaaaattgattcagacatgttt |
196 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
470492 |
gcttttctttttttaaatcaactaccccatttttagaggatcaaaattaatttagaaaactcaaaattgattcagacatgttt |
470410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University