View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12837_high_9 (Length: 218)
Name: NF12837_high_9
Description: NF12837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12837_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 36051594 - 36051803
Alignment:
| Q |
1 |
cgcagaaaacttaacaaacctgatctccattgttgaccttcaaccaccgcaccccactaaaatcataggttctgtatcaatcacaacttcaggggtcgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36051594 |
cgcagaaaacttaacaaacctgatctccattgttgaccttcaaccaccgcaccccactaaaatcataggttctgtatcaatcacaacttcaggggtcgtg |
36051693 |
T |
 |
| Q |
101 |
tcttat-ccaaggacaccggttttgactatgatacggatatctcaattctggggaaaatccaccaccctgcagctcttgcaaaatgtacaaacctatctg |
199 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36051694 |
tcttatcccaaggacaccggttttgacgatgatacggatatctcaattctggggaaaatccaccaccctgcagctcttgcaaaatgtacaaacctatctg |
36051793 |
T |
 |
| Q |
200 |
atgtccatct |
209 |
Q |
| |
|
|| ||||||| |
|
|
| T |
36051794 |
atttccatct |
36051803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University