View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12837_low_5 (Length: 338)
Name: NF12837_low_5
Description: NF12837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12837_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 91 - 317
Target Start/End: Original strand, 40375179 - 40375410
Alignment:
| Q |
91 |
cccaaataaagttaaggcagttcataaagctgaaagactcagagcatatacaaaccctcttggttaaaagtttttcttatttacga-tttgttgcaaaat |
189 |
Q |
| |
|
||||| |||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||| |
|
|
| T |
40375179 |
cccaattaaaattaaggcagttcgtaacgctgaaagactcagagcatatacaaaccctcttggttaaaagttttttttatttatgaatttgttgcaaaat |
40375278 |
T |
 |
| Q |
190 |
agaactcgttatatttagaaatgagttttattttaaaattagg----ttgctagaccctttatttgtgtggaaatgatctcaaacatttaagaaggccaa |
285 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40375279 |
agaactcattatatttagaaatgagttttattttaaaattaggtaggttgctagaccctttatttgtgtggaaatgatctcaaacatttaggaaggccaa |
40375378 |
T |
 |
| Q |
286 |
atcataattgtttcatgttgactgatggtgat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40375379 |
atcataattgtttcatgttgactgatggtgat |
40375410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 654118 - 654073
Alignment:
| Q |
257 |
aaatgatctcaaacatttaagaaggccaaatcataattgtttcatg |
302 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
654118 |
aaataatctcaaacatttaagaagaccaaatcataatagtttcatg |
654073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University