View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12838_high_18 (Length: 245)
Name: NF12838_high_18
Description: NF12838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12838_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 37 - 242
Target Start/End: Complemental strand, 47998416 - 47998211
Alignment:
| Q |
37 |
gggtctctagaagtgagcaaaagaacctcatgtgcagtgatgatagccttaatttgttccaagtttaagacaattgctctgtcacgccccacgattgtgg |
136 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47998416 |
gggtctctagaattgagcaaaagaacctcatgtgcagtgatgatagccttaatttgttccaagtttaagacaattgctctgtcacgccccacgattgtgg |
47998317 |
T |
 |
| Q |
137 |
aagagtatgacaacataggatcaagaatcctaaagtccctagcagtcagccctgtcctctgcattatcaactgcctacttgcttccaccatctgtctctg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47998316 |
aagagtatgacaacataggatcaagaatcctaaagtccctagcagtcagccctgtcctctgcattatcaactgcctacttgcctccaccatctgtctctg |
47998217 |
T |
 |
| Q |
237 |
ctcctc |
242 |
Q |
| |
|
| |||| |
|
|
| T |
47998216 |
cccctc |
47998211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University