View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12838_high_21 (Length: 231)
Name: NF12838_high_21
Description: NF12838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12838_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 11654549 - 11654503
Alignment:
| Q |
1 |
gagtagacgatgagggtggtgggtttttcggtgtagaagggctttta |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11654549 |
gagtagacgatgagggtggtgggtttttcggtgtagaagggctttta |
11654503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 11668314 - 11668268
Alignment:
| Q |
1 |
gagtagacgatgagggtggtgggtttttcggtgtagaagggctttta |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11668314 |
gagtagacgatgagggtggtgggtttttcggtgtagaagggctttta |
11668268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 126 - 160
Target Start/End: Complemental strand, 11654418 - 11654384
Alignment:
| Q |
126 |
ttatgttggttatgtggtggagaagagctattagg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11654418 |
ttatgttggttatgtggtggagaagagctattagg |
11654384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 126 - 160
Target Start/End: Complemental strand, 11668183 - 11668149
Alignment:
| Q |
126 |
ttatgttggttatgtggtggagaagagctattagg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11668183 |
ttatgttggttatgtggtggagaagagctattagg |
11668149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University