View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12838_high_6 (Length: 344)
Name: NF12838_high_6
Description: NF12838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12838_high_6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 344
Target Start/End: Original strand, 16435242 - 16435585
Alignment:
| Q |
1 |
atcattttttaatataattctttggtgtgaggagtggtagaaaggggaggttaggtttcatttttatttggcatgctgttttttggactatatgaagtac |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16435242 |
atcattttttaatataattctctggtgtgaggagtggtagaaaggggaggttaggtttcattcttatttggcatgctgttttttggactatatgaagtac |
16435341 |
T |
 |
| Q |
101 |
ccgcaatgattttatctttattggggatctatttatgttgagactttggtgggtaaggtcaaactttacctatgaaagtggttcctaggtaagaacgttg |
200 |
Q |
| |
|
|| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16435342 |
ccccaatgattttatttttattggggatctatttatgttgagactttggtgggtaaggtcaaactttacctatgaaagtggttcctaggtaagaacgttg |
16435441 |
T |
 |
| Q |
201 |
gttgcccttgctcctttttcgagtgagagaccaatctcgtcatgtgctagtcttgttagtgttttgtagtagtagtgttagagtcttagtgggttttgtg |
300 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16435442 |
gttgcccttgctcctttttcgagcgagagaccaatctcgtcatgtgctagtcttgttagtgttttgtagtagtagtgttagagtcttagtgggttttgtc |
16435541 |
T |
 |
| Q |
301 |
tggtttcgctgttggttctcgaccgatccttttgttgttgtcct |
344 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
16435542 |
tggtttcgttgttggttctcgaccgatccttttgtggttgtcct |
16435585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University