View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12838_low_22 (Length: 231)

Name: NF12838_low_22
Description: NF12838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12838_low_22
NF12838_low_22
[»] chr2 (4 HSPs)
chr2 (1-47)||(11654503-11654549)
chr2 (1-47)||(11668268-11668314)
chr2 (126-160)||(11654384-11654418)
chr2 (126-160)||(11668149-11668183)


Alignment Details
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 11654549 - 11654503
Alignment:
1 gagtagacgatgagggtggtgggtttttcggtgtagaagggctttta 47  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
11654549 gagtagacgatgagggtggtgggtttttcggtgtagaagggctttta 11654503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 11668314 - 11668268
Alignment:
1 gagtagacgatgagggtggtgggtttttcggtgtagaagggctttta 47  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
11668314 gagtagacgatgagggtggtgggtttttcggtgtagaagggctttta 11668268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 126 - 160
Target Start/End: Complemental strand, 11654418 - 11654384
Alignment:
126 ttatgttggttatgtggtggagaagagctattagg 160  Q
    |||||||||||||||||||||||||||||||||||    
11654418 ttatgttggttatgtggtggagaagagctattagg 11654384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 126 - 160
Target Start/End: Complemental strand, 11668183 - 11668149
Alignment:
126 ttatgttggttatgtggtggagaagagctattagg 160  Q
    |||||||||||||||||||||||||||||||||||    
11668183 ttatgttggttatgtggtggagaagagctattagg 11668149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University