View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12838_low_24 (Length: 215)
Name: NF12838_low_24
Description: NF12838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12838_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 2829497 - 2829314
Alignment:
| Q |
16 |
tgtggagctggagaacaaagtggaggaatttaatcagaatgttactttacacgaggtaaactaacgctataactatttgcaaaagcatttttgttccacg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2829497 |
tgtggagctggagaacaaagtggaggaatttaatcagaatgttactttacacgaggtaaactaacgctataactatttgcaaaagcatttttgttccaca |
2829398 |
T |
|
| Q |
116 |
aaacctgaattagaaactttgtcttgcttagttcaaactttcattgttgaaatgtggattgataatgaagcaattgaattacat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2829397 |
aaacctgaattagaaactttgtcttgcttagttcaaactttcattgttgaaatgtggattgataatgaagcaattgaattacat |
2829314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University