View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12838_low_5 (Length: 345)
Name: NF12838_low_5
Description: NF12838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12838_low_5 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 182 - 345
Target Start/End: Original strand, 39083991 - 39084154
Alignment:
| Q |
182 |
tctgaattctaacattgagtggatgattcccaccgcaatggaagaatcaatttccacaactaattatgctacatcagcatcatccactggggaatgattt |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
39083991 |
tctgaattctaacattgagtggatgattcccactgcaatggaagaatcaatttccacaactaattatgctacatcagcatcatccactcgggattgattt |
39084090 |
T |
|
| Q |
282 |
gattttgttagggctgtgaaagctactaaacagaaaaatggaaaagctggagattggttggcct |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39084091 |
gattttgttagggctgtgaaagctactaaacagaaaaatggaaaagctggagattggttggcct |
39084154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 20 - 70
Target Start/End: Original strand, 39083820 - 39083870
Alignment:
| Q |
20 |
tggtattttacttattactatgacatttgaattgtgtgtagcgtgatagct |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39083820 |
tggtattttacttattactatgacatttgaattgtgtgtagcgtgatagct |
39083870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University