View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12838_low_8 (Length: 303)
Name: NF12838_low_8
Description: NF12838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12838_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 42086812 - 42087096
Alignment:
| Q |
1 |
ataatagtaaatgattgggcaccacaagttgagatattatcacatggatcagtttctgcgtttttgagtcattgtggttggaactcagtgttggaatcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42086812 |
ataatagtaaatgattgggcaccacaagttgagatattgtcacatggatcagtttctgcgtttttgagtcattgtggttggaactcggtgttggaatcat |
42086911 |
T |
|
| Q |
101 |
tgagtcatggtgtacctattcttgggtggccgattgcggcggagcagttttttaattgtaagctgttggaagaagagatgggtgtttgtgttgaggttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42086912 |
tgagtcatggtgtacctattcttgggtggccgatggcggcggagcagttttttaattgtaagctgttggaagaagagatgggtgtttgtgttgaggttgc |
42087011 |
T |
|
| Q |
201 |
tagaggaaagagttgtgaagtgaagtatgaagatattgttgagaaaattgagttggttatgggtgagagtagtgagagtggggtg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087012 |
tagaggaaagagttgtgaagtgaagtatgaagatattgttgagaaaattgagttggttatgggtgagagtagtgagagtggggtg |
42087096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 61 - 98
Target Start/End: Complemental strand, 24462298 - 24462261
Alignment:
| Q |
61 |
tttttgagtcattgtggttggaactcagtgttggaatc |
98 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
24462298 |
tttttgactcattgtggatggaactcagtgttggaatc |
24462261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University