View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12839_high_17 (Length: 249)
Name: NF12839_high_17
Description: NF12839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12839_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 14559722 - 14559482
Alignment:
| Q |
1 |
atttccttggtattagattcaatggacatattctattttgttgattaactgaaggatttgtcttattttgaagagattggttggaaaaatttagctggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14559722 |
atttccttggtattagattcaatggacatattctattttgttgattaactgaaggatttgtcttattttgaagagattggttggaaaaatttagctggtt |
14559623 |
T |
 |
| Q |
101 |
cagtgtaactgaagtgatatctgcaagtggtgttaaagaaggggaactttttatatcaagtgattttttattgactttggaactggaaacctctttcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14559622 |
cagtgtaactgaagtgatatctgcaagtggtgttaaagaaggggaactttttatatcaagtgattttttattgactttggaactggaaacctctttcttt |
14559523 |
T |
 |
| Q |
201 |
gttgtcttttgtttagcaaattgggacaatctctttcttct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14559522 |
gttgtcttttgtttagcaaattgggacaatctctttcttct |
14559482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 19768374 - 19768135
Alignment:
| Q |
1 |
atttccttggtattagattcaatggacatattctattttgttgattaactgaaggatttgtcttattttgaagagattggttggaaaaatttagctggtt |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
19768374 |
atttccttggtattaggttcaatggacatattctattttgttgattaactgaaggatttgtcttattttaaagagattggttggaagaattttgctggtt |
19768275 |
T |
 |
| Q |
101 |
cagtgtaactgaagtgatatctgcaagtggtgttaaagaaggggaactttttatatcaagtgattttttattgactttggaactggaaacctctttcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19768274 |
cagtgtaactgaagtgatatctgcaagtggtgttaaagaatgagaactttttatatcaagtgattttttattgactttggaactggaaacctctttcttt |
19768175 |
T |
 |
| Q |
201 |
gttgtcttttgtttagcaaattgggacaatctctttcttc |
240 |
Q |
| |
|
| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19768174 |
gatgtcttttgtttagcaacttgggacaatctctttcttc |
19768135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University