View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12839_high_22 (Length: 209)
Name: NF12839_high_22
Description: NF12839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12839_high_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 24992702 - 24992864
Alignment:
| Q |
18 |
gttacagtactcaaaattattcttaaataaattattaagaaaaggatatgaatatgtatggcctctgggatatagttgctaacagttgctaaagtggttc |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
24992702 |
gttacagtagtcaaaattattcttaaataaattattaagaaaaggatatgaatatgtatggcctctgggatat----------agttgctaatgtggttc |
24992791 |
T |
 |
| Q |
118 |
gatttgacgannnnnnnacgcaattttattgtgttcgttgattgtggtgtcttctctccctatttgtggttac |
190 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24992792 |
gatttgacgatttttttactcaattttattgtgttcgttgattgtggtgtcttctctccctatttgtggttac |
24992864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University