View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12839_high_8 (Length: 308)
Name: NF12839_high_8
Description: NF12839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12839_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 69 - 294
Target Start/End: Complemental strand, 36541034 - 36540811
Alignment:
| Q |
69 |
cttattagttcaagctcttgtagttatcaatagatagtacatacccatacattcaatgaggcgctggaaactaataaatttctacctatcttgcttgcnn |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36541034 |
cttattagttcaagctcttgtagttatcaatagatagtacatacccatacattaaatgaggcgctggaaactaataaatttctacctatcttgcttgctt |
36540935 |
T |
 |
| Q |
169 |
nnnnnnnnnnnnngttcaccctctggttctagcagaaagaggtctagtaattcagagttgagttaagtaaattcttacaaaatattgttccatttaagaa |
268 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36540934 |
ttttttttttg--gttcaccctctagttctagcggaaagaggtctagtaattcagagttgagttaagtaaattcttataaaatattgttccatttaagaa |
36540837 |
T |
 |
| Q |
269 |
tcaaattatcacgaacaattcgtctt |
294 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36540836 |
tcaaattatcacgaacaattcgtctt |
36540811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 36541458 - 36541412
Alignment:
| Q |
18 |
gatttctattgtaacaacatgaatagcaacagatattttctatttct |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
36541458 |
gatttctattgtaacaacatgaatagcaacaaatgttttctatttct |
36541412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University