View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12839_low_12 (Length: 315)
Name: NF12839_low_12
Description: NF12839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12839_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 208 - 299
Target Start/End: Original strand, 29248366 - 29248457
Alignment:
| Q |
208 |
gaggtgaaggaggaggggaagaggaagtatattgaacttattcatgagctaggattcaagagaaagtattctgtaagtactaagtatctatg |
299 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
29248366 |
gaggtggaggaggaggggaagaggaagtatattgaacttattcatgagctaggattcaagagaaaatattctgtaagtactaagtatatatg |
29248457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 91 - 132
Target Start/End: Original strand, 29248310 - 29248353
Alignment:
| Q |
91 |
aggaagtgcatgtgaacctcccccattccc--gagtttaatgat |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29248310 |
aggaagtgcatgtgaacctcccccattcccctgagtttaatgat |
29248353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University