View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12839_low_12 (Length: 315)

Name: NF12839_low_12
Description: NF12839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12839_low_12
NF12839_low_12
[»] chr5 (2 HSPs)
chr5 (208-299)||(29248366-29248457)
chr5 (91-132)||(29248310-29248353)


Alignment Details
Target: chr5 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 208 - 299
Target Start/End: Original strand, 29248366 - 29248457
Alignment:
208 gaggtgaaggaggaggggaagaggaagtatattgaacttattcatgagctaggattcaagagaaagtattctgtaagtactaagtatctatg 299  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||    
29248366 gaggtggaggaggaggggaagaggaagtatattgaacttattcatgagctaggattcaagagaaaatattctgtaagtactaagtatatatg 29248457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 91 - 132
Target Start/End: Original strand, 29248310 - 29248353
Alignment:
91 aggaagtgcatgtgaacctcccccattccc--gagtttaatgat 132  Q
    ||||||||||||||||||||||||||||||  ||||||||||||    
29248310 aggaagtgcatgtgaacctcccccattcccctgagtttaatgat 29248353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University