View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12839_low_16 (Length: 301)
Name: NF12839_low_16
Description: NF12839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12839_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 10 - 276
Target Start/End: Complemental strand, 17975493 - 17975227
Alignment:
| Q |
10 |
ttcactgataaaaagggagactccttcgtcccaaatatagaggcttttttgaagatggtcccaaatatagagtttaaacatttcgtgatgacatcctcga |
109 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17975493 |
ttcagtgataaaaagggagactccttcatcccaaatatagaggcttttttgaagatggtcccaaatatagagtttaaacatttcgtgatgacatcctcta |
17975394 |
T |
 |
| Q |
110 |
atcaaacattgttgaacaatgatgcttttcttgatggcatgcagggcgccaggcacagacttttttccacatcaacttcttccaactttatgaatgataa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17975393 |
atcaaacattgttgaacaatgatgcttttcttgatagcatgcagggcgccaggcacggacttttttccacatcaacttcttccaactttgggaatgataa |
17975294 |
T |
 |
| Q |
210 |
aagcaatggtttccttgggaataattctatggcagtgtcgagtaatgtgtcaagagagccaaacact |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17975293 |
aagcaatggtttccttgggaataattctatggcagtgtcgagtaatgtgtcaagtgagccaaacact |
17975227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University