View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12839_low_17 (Length: 286)
Name: NF12839_low_17
Description: NF12839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12839_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 273
Target Start/End: Complemental strand, 40409137 - 40408883
Alignment:
| Q |
19 |
gttgtgccatgctgctaagtctgctcatgctcctcaacctggcagtactcattctgagaatggtcatggtagtgctccttagcagcatctccttaataac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40409137 |
gttgtgccatgctgctaagtctgctcatgctcctcaacctggcagtactcattctgagaatggtcatggtagtgctccttagcagcatctccttaataac |
40409038 |
T |
|
| Q |
119 |
tacataatactggtcttgagaagggtccaaaacatgggacgcactgtttgtgaagtcccttccaaaccacccctacgattacgtcccctcttagacatag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40409037 |
tacataatactggtcttgagaagggtccaaaacatgggacgcactgtttgtgaagtcccttccaaaccacccctacgattacgtcccctcttagacatag |
40408938 |
T |
|
| Q |
219 |
ggtttgcgcatgtctctccctgcatgtactagaggttatcgttgagtttgcgcct |
273 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40408937 |
ggtttgcgcatgcctctccctgcatgtactagaggttatcgttgagtttgcgcct |
40408883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University