View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12839_low_22 (Length: 254)
Name: NF12839_low_22
Description: NF12839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12839_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 11 - 237
Target Start/End: Complemental strand, 37831733 - 37831498
Alignment:
| Q |
11 |
gaaacagccaagaacaaaatccatttaaatgatatggatgtaactgttgttttcagtgtggtagtaaccaaagttgtggacaaagctatctatcaagtta |
110 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37831733 |
gaaacagccaagaacaaaaaccattgaaatgatatggatgtaactgttgttttcagtgtgttagtaaccaaagttgtggacaaagctatatatcaagtta |
37831634 |
T |
 |
| Q |
111 |
agagttttggatttgaagttcattcacgagtgaag---------caaatgaacttgtactatgagatacaaatgccacataaattccatggctggattgc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37831633 |
agagttttggatttgaagttcattcacgagtgaagcaaaaactgcaaatgaacttgtactatgagatacaaatgccacataaattccatggctggattgc |
37831534 |
T |
 |
| Q |
202 |
tcaacaatttttactttttcaggatgtagtatatta |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37831533 |
tcaacaatttttactttttcaggatgtagtatatta |
37831498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University