View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12839_low_29 (Length: 232)
Name: NF12839_low_29
Description: NF12839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12839_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 5397570 - 5397790
Alignment:
| Q |
19 |
gtttttagtatttgtttttctgaaaacgacagagagtagaagtagtaagatgattggatagtgggatacaaaaactcatctttgctttatttcatctctt |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5397570 |
gtttttagtatttgtttttctgtaaacgacagagagtagaagtagtaagatgattggatagtgggatacaaaaactcatctttgctttatttcatctctt |
5397669 |
T |
|
| Q |
119 |
gaaatgatcccacactttccaactaaccacactacattttgtagtgaca-------------------tcgagaagcttaaggcaagtgagagcataagc |
199 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5397670 |
gaaatgatcccacactttccaactaatcacactacattttgtagtgacagcagatcatggctcgagagtcgagaagcttaaggcaagtgagagcataagc |
5397769 |
T |
|
| Q |
200 |
cttaaaccccaccttcatctc |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5397770 |
cttaaaccccaccttcatctc |
5397790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University