View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12839_low_8 (Length: 374)
Name: NF12839_low_8
Description: NF12839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12839_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 15 - 354
Target Start/End: Original strand, 13212421 - 13212760
Alignment:
| Q |
15 |
ttcactggtgtttcttcatcttctaaaggtagcctttcataagcagcatttccaaaggaagctgccatgataacaaccggaccggaagctaacaacggtc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212421 |
ttcactggtgtttcttcatcttctaaaggtagcctttcataagcagcatttccaaaggaagctgccatgataacaaccggaccggaagctaacaacggtc |
13212520 |
T |
|
| Q |
115 |
ccaccacgctaccaccgacgacctgtccttgtccaccagctagatatatggctaatcctgacgccgctggtggagcaggcggcggcaggaaagagccaga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212521 |
ccaccacgctaccaccgacgacctgtccttgtccaccagctagatatatggctaatcctgacgccgctggtggagcaggcggcggcaggaaagagccaga |
13212620 |
T |
|
| Q |
215 |
taatgataatatctcaaatcttccatgaagtgtgactaccgcaccaggcgatgctggttgacggagagtcacgtttgtgacggtcccacttccgctaagg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212621 |
taatgataatatctcaaatcttccatgaagtgtgactaccgcaccaggcgatgctggttgacggagagtcacgtttgtgacggtcccacttccgctaagg |
13212720 |
T |
|
| Q |
315 |
atgcagacaccacgctgcctccttcgcgcaaagaccgtca |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212721 |
atgcagacaccacgctgcctccttcgcgcaaagaccgtca |
13212760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University