View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1283_high_12 (Length: 361)
Name: NF1283_high_12
Description: NF1283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1283_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 55 - 329
Target Start/End: Complemental strand, 26491661 - 26491387
Alignment:
| Q |
55 |
ttgataacaggaaaaattccatatgcagtggaaaatggctctcaaagagattgggctggagaatatataagaggacaaccattgagagagatggttgata |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26491661 |
ttgataacaggaaaaattccatatgcagtggaaaatggctctcaaacagattgggctggagaatatataagaggacaaccattgagagagatggttgata |
26491562 |
T |
|
| Q |
155 |
caagcttgaactctttgaaagatgatgaaattgagaaatggtgtgaagtgattaacaattgtgtagatcttgatcaagaaacaagaccatcaatgaaaga |
254 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26491561 |
caaggttgaactctttgaaagatgatgaaattgagaaatggtgtgaagtgattaacaattgtgtagatcttgatcaagaaacaaggtcatcaatgaaaga |
26491462 |
T |
|
| Q |
255 |
gattacatctaagttgaaggagattactgatatgggacctgatggagcaactccaaaatcatcccctctgtggtg |
329 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26491461 |
gattacatctaaattgaaggagattactgatatggggcctgatggagcaactccaaaatcatcccctctttggtg |
26491387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University