View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1283_high_16 (Length: 303)
Name: NF1283_high_16
Description: NF1283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1283_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 97 - 278
Target Start/End: Complemental strand, 37494957 - 37494776
Alignment:
| Q |
97 |
tatacgtatacttggatattatttaataactttagaagaactttagtagatatggaagataattaccacaagttgaatgtcccttttgtatgttttacag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37494957 |
tatacgtatacttggatattatttaataactttagaagaactttagtagatatggaagataattaccacaagttgaatgtcccttttgtatgttttacag |
37494858 |
T |
 |
| Q |
197 |
tgggtcatattgatggcaatattaacgtttattcttacactgctgctggattgcatctaggaggactcgtctgtggtgctgc |
278 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
37494857 |
tgggtcatattgatggcaacattaacgtttattcttacactgctgctggattgcatctaggaggactcgtgtgtgctgctgc |
37494776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University