View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1283_high_21 (Length: 265)
Name: NF1283_high_21
Description: NF1283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1283_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 44 - 241
Target Start/End: Complemental strand, 27867140 - 27866943
Alignment:
| Q |
44 |
gattgaagttgttgttaaaatcgtattaggatatgtgttacacgtcggtggattgaatcctgagataggaggaggcgtctttttaggtaaaatgagttgc |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27867140 |
gattgaagttgttgttaaaatcgtattaggatatgtgttacacgtcggtgtattgaatcctgagataggaggaggcgtctttttaggtaaaatgagctgc |
27867041 |
T |
 |
| Q |
144 |
ttgatgtgaggaactgtgaagtcacttccgatattcaaaaatgctcatatgcttatcttttggtatgatgttggaaattggttcgatgccacttcatc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
27867040 |
ttgatgtgaggaactgtgaagtcacttccgatattcaaaaatgctcatatgcttatcttttgggatgatgttggaaataggttcgatgccacttcatc |
27866943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 44 - 227
Target Start/End: Complemental strand, 27971479 - 27971296
Alignment:
| Q |
44 |
gattgaagttgttgttaaaatcgtattaggatatgtgttacacgtcggtggattgaatcctgagataggaggaggcgtctttttaggtaaaatgagttgc |
143 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||| || ||||| |||||| |
|
|
| T |
27971479 |
gattgaagttgttgttgaaatcatattacgatatgtgttacacgttggtgtattgaatcctgagataggaggaggcgtctttctaagtaaaccaagttgc |
27971380 |
T |
 |
| Q |
144 |
ttgatgtgaggaactgtgaagtcacttccgatattcaaaaatgctcatatgcttatcttttggtatgatgttggaaattggttc |
227 |
Q |
| |
|
||||||||||||||| | |||| ||||| ||||||| |||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
27971379 |
ttgatgtgaggaactataaagttacttcggatattcgaaaatgctcatatgcttatcttttgggatgatgttggaaataggttc |
27971296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 44 - 227
Target Start/End: Complemental strand, 28028748 - 28028565
Alignment:
| Q |
44 |
gattgaagttgttgttaaaatcgtattaggatatgtgttacacgtcggtggattgaatcctgagataggaggaggcgtctttttaggtaaaatgagttgc |
143 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||| || ||||| |||||| |
|
|
| T |
28028748 |
gattgaagttgttgttgaaatcatattacgatatgtgttacacgttggtgtattgaatcctgagataggaggaggcgtctttctaagtaaaccaagttgc |
28028649 |
T |
 |
| Q |
144 |
ttgatgtgaggaactgtgaagtcacttccgatattcaaaaatgctcatatgcttatcttttggtatgatgttggaaattggttc |
227 |
Q |
| |
|
||||||||||||||| | |||| ||||| ||||||| |||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
28028648 |
ttgatgtgaggaactataaagttacttcggatattcgaaaatgctcatatgcttatcttttgggatgatgttggaaataggttc |
28028565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 79 - 221
Target Start/End: Complemental strand, 27896090 - 27895948
Alignment:
| Q |
79 |
tgttacacgtcggtggattgaatcctgagataggaggaggcgtctttttaggtaaaatgagttgcttgatgtgaggaactgtgaagtcacttccgatatt |
178 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||| || |||||| |||||||||||||||||||||| |||||| ||||| |||||| |
|
|
| T |
27896090 |
tgttacacgtcggtgtattgaattctgagataggaggaggcgtctttctaagtaaaacgagttgcttgatgtgaggaactatgaagttacttcggatatt |
27895991 |
T |
 |
| Q |
179 |
caaaaatgctcatatgcttatcttttggtatgatgttggaaat |
221 |
Q |
| |
|
| ||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
27895990 |
cgaaaatgctcatatgcttattttttgggatgatgttggaaat |
27895948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 79 - 221
Target Start/End: Complemental strand, 27908329 - 27908187
Alignment:
| Q |
79 |
tgttacacgtcggtggattgaatcctgagataggaggaggcgtctttttaggtaaaatgagttgcttgatgtgaggaactgtgaagtcacttccgatatt |
178 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||| || |||||| |||||||||||||||||||||| |||||| ||||| |||||| |
|
|
| T |
27908329 |
tgttacacgtcggtgtattgaattctgagataggaggaggcgtctttctaagtaaaacgagttgcttgatgtgaggaactatgaagttacttcggatatt |
27908230 |
T |
 |
| Q |
179 |
caaaaatgctcatatgcttatcttttggtatgatgttggaaat |
221 |
Q |
| |
|
| ||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
27908229 |
cgaaaatgctcatatgcttattttttgggatgatgttggaaat |
27908187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 79 - 221
Target Start/End: Complemental strand, 27954748 - 27954606
Alignment:
| Q |
79 |
tgttacacgtcggtggattgaatcctgagataggaggaggcgtctttttaggtaaaatgagttgcttgatgtgaggaactgtgaagtcacttccgatatt |
178 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||| || |||||| |||||||||||||||||||||| |||||| ||||| |||||| |
|
|
| T |
27954748 |
tgttacacgtcggtgtattgaattctgagataggaggaggcgtctttctaagtaaaacgagttgcttgatgtgaggaactatgaagttacttcggatatt |
27954649 |
T |
 |
| Q |
179 |
caaaaatgctcatatgcttatcttttggtatgatgttggaaat |
221 |
Q |
| |
|
| ||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
27954648 |
cgaaaatgctcatatgcttattttttgggatgatgttggaaat |
27954606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University