View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1283_high_29 (Length: 212)
Name: NF1283_high_29
Description: NF1283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1283_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 129 - 199
Target Start/End: Complemental strand, 31069137 - 31069067
Alignment:
| Q |
129 |
gaaattataacaaatgggttgaaaaggatttttaatgaaaaggggtgagatttgggtaaatggtgatgatg |
199 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31069137 |
gaaattataacaaatgggttgaaaagggtttttaatgaaaaggggtgagatttgggtaaatggtgatgatg |
31069067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 70
Target Start/End: Complemental strand, 31069226 - 31069196
Alignment:
| Q |
40 |
attattgtttggtcgatattgagatctagtg |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31069226 |
attattgtttggtcgatattgagatctagtg |
31069196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University