View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1283_high_30 (Length: 207)
Name: NF1283_high_30
Description: NF1283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1283_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 162
Target Start/End: Complemental strand, 39058306 - 39058162
Alignment:
| Q |
18 |
catcatcttctttatatgatgtatcttctgttcttgtaaggagttactctccattgcttttgtcagtaaaattcaatggctaacaaacaacatacccctc |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39058306 |
catcctcttctttatatgatgtatcttctgttcttgtaaggagttactctccattgcttttgtcagtaaaattcaatggctaacaaacaacatacccctc |
39058207 |
T |
 |
| Q |
118 |
ttagaataaatgaaatatttgtcaaacatgaataatagctacaac |
162 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39058206 |
ttagaataaatgaaatatttgtcaatcatgaataatagctacaac |
39058162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University