View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1283_low_18 (Length: 355)
Name: NF1283_low_18
Description: NF1283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1283_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 136 - 231
Target Start/End: Original strand, 46303309 - 46303404
Alignment:
| Q |
136 |
ctccttgactgggatgatgtacacaatgatgacttttgctcatggcgtggagttttctgtgataacgccagtcatgctcttactgttgtatctctg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46303309 |
ctccttgactgggatgatgtacacaatgatgacttttgctcatggcgtggagttttctgtgataacgccagtcatgctcttactgttgtatctctg |
46303404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University