View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1283_low_27 (Length: 297)
Name: NF1283_low_27
Description: NF1283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1283_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 26411159 - 26410917
Alignment:
| Q |
1 |
cacaagtaacaaaaaggaggctatataagcggacctaaccaaaaaacacatcatccgagcattgcttctaggacaaagagtcaaaaccctcaaaaagacg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26411159 |
cacaagtaacaaaaaggtggctatataagcggacctaaccaaaaaacacaccatccgagcattgcttctaggacaaagagtcagaaccctcaaaaagacg |
26411060 |
T |
|
| Q |
101 |
gtgtatctccaacacacctaacaattccaccactaaggttttctcccaaacaaaaaggctccgcctccaactcaactcccaatattgtatgattgaat-- |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26411059 |
gtgtatctccaacacacctaacaattccaccactaaggttttctcccaaacaaaaaggctccgcctccaactcaactctcaatattgtatgattgaatga |
26410960 |
T |
|
| Q |
199 |
--gattacttttgtcgagttgaatatactctttaattaatatt |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
26410959 |
ttgattacttttgtcgagttatatatactctctaattaatatt |
26410917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University