View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1283_low_9 (Length: 417)
Name: NF1283_low_9
Description: NF1283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1283_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 10612771 - 10612829
Alignment:
| Q |
1 |
tatcatagcttagagtttgaaacagagagaaaggtattgagaagtgagttttcagtatt |
59 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10612771 |
tatcatagcttagagtttgaagcagagagaaaggtattgagaagtgagttttcagtatt |
10612829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 37972738 - 37972686
Alignment:
| Q |
218 |
tgtgacaacactttatattgttcgttaataggctcacacaactcatgaactca |
270 |
Q |
| |
|
|||||| ||||| ||||||||| |||||| || |||| ||||||||||||||| |
|
|
| T |
37972738 |
tgtgactacactatatattgtttgttaatgggatcacgcaactcatgaactca |
37972686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University