View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1284-Insertion-4 (Length: 95)
Name: NF1284-Insertion-4
Description: NF1284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1284-Insertion-4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 4e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 4e-38
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 24260834 - 24260751
Alignment:
| Q |
8 |
atactctcaaagtaatccaccaattcaatcagatattcaatatgatgttgtgattgtgatatactaaatttataatgattccct |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24260834 |
atactctcaaagtaatccaccaattcaatcagatattcaatatgatgttgtgattgtaatatactaaatttataatgattccct |
24260751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University