View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12841_high_20 (Length: 418)
Name: NF12841_high_20
Description: NF12841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12841_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 41592567 - 41592362
Alignment:
| Q |
1 |
ttttccttcatcaaacatgcattacctgagatagcaaatgaatcaccagtgctggctccactgttttgcttctctacaagtacactgctttcaatacagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41592567 |
ttttccttcatcaaacatgcattacctgagatagcaaatgaatcaccagtgctggctccactgttttgcttctctacaagtacactgctttcaatacagc |
41592468 |
T |
|
| Q |
101 |
tgtttggcattacttcagtatgtgattgaacccccnnnnnnnnnnnnnnncttactttctgtgaatcatctttaggctttctttggctggaagatcctct |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41592467 |
tgtttggcattacttcattatgtgattgaaccccctttttttcattttttcttactttctgtgaatcatctttaggctttctttggctggaagatcctct |
41592368 |
T |
|
| Q |
201 |
gcgaac |
206 |
Q |
| |
|
|||||| |
|
|
| T |
41592367 |
gcgaac |
41592362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 250 - 404
Target Start/End: Complemental strand, 41592321 - 41592167
Alignment:
| Q |
250 |
aacaaacctgtggcaagagttgcacctttgaagtttccatccacttgtgaaatctcttggcacaaggaagtaccatgtggatttttggccgagttatgtt |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
41592321 |
aacaaacctgtggcaagagttgcacctttgaagtttccatccacttgtgaaatctcttggcacaaggtagtaccaagtggatttttggccgagttatgtt |
41592222 |
T |
|
| Q |
350 |
ggttcttggtgcttttggaatactttctcttggaaccctttgcttcagtggaatt |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41592221 |
ggttcttggtgcttttggaatactttctcttggaaccctttgcttcagtggaatt |
41592167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University