View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12841_high_38 (Length: 269)
Name: NF12841_high_38
Description: NF12841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12841_high_38 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 4 - 269
Target Start/End: Original strand, 3054255 - 3054520
Alignment:
| Q |
4 |
acagaggggatattcaacaaataaacttcccaccttaattcctaaacatcttgatgatgagccttttgtctgactctgctgccagatggcctgctgcttc |
103 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3054255 |
acaggggggatattcaacaaacaaacttcccaccttaattcctaaacatccggatgatgagccttttgtctgactctgctgccagatggcctgctgcttc |
3054354 |
T |
 |
| Q |
104 |
agaattggttatttgttgactttgaaattttgaatcataatattaccaccccccgttacaaacaaccttgttctcaaggttgaaatttgttagaataaag |
203 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3054355 |
aaaattggttatttgttgactttgaaattttgaatcataatattaccaccccccgttacaaacaaccttgttctcaaggttgaaatttgttagaataaag |
3054454 |
T |
 |
| Q |
204 |
aaaatctttctataatcatttaattgtacaaccccctagattaatattcctagaatatacaacttc |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3054455 |
aaaatctttctataatcatttaattgtacaacctcctagattaatattcctagaatatacaacttc |
3054520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University