View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12841_low_17 (Length: 436)
Name: NF12841_low_17
Description: NF12841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12841_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 7e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 29 - 199
Target Start/End: Original strand, 9126510 - 9126681
Alignment:
| Q |
29 |
gcctcaagcctcaaaagattctgtggatgacaagattccatcaatcaataattttc-caagagaatcattggttataaaatgtacattatggcgcaatta |
127 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9126510 |
gcctcacgcctcaaaagattctgcggatgacaagattcaatcaatcaataattttttcaagagaaccattggttataaaatgtacattatggcgcaatta |
9126609 |
T |
 |
| Q |
128 |
ttaacttctacaccaaagtttgagcacttttgacaaggaaaatcatatagatgaatcaccaatttaatctct |
199 |
Q |
| |
|
|||||||||| ||||||| |||| || ||||||||| |||||| |||||||||||||||||||||| ||||| |
|
|
| T |
9126610 |
ttaacttctaaaccaaaggttgaacaattttgacaaagaaaatgatatagatgaatcaccaatttagtctct |
9126681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 9132567 - 9132641
Alignment:
| Q |
20 |
gtgtctcatgcctcaagcctcaaaagattctgtggatgacaagattccatcaatcaataattttccaagagaatc |
94 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||| |||| ||||||||| |
|
|
| T |
9132567 |
gtgtctcatgcctcacgcctcaaaagattctgcagatgacaagattcaatcaatcaataaatttcaaagagaatc |
9132641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University