View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12841_low_32 (Length: 350)
Name: NF12841_low_32
Description: NF12841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12841_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 96 - 334
Target Start/End: Original strand, 9132352 - 9132590
Alignment:
| Q |
96 |
acacacactgatagaggtactattgtctttgattttctggaaaacaaagcaattcaaacaactacaaaactaaagaaagtactgttggaatgaacattct |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9132352 |
acacacactgatagaggtactattgtctttgattttctggaaaacaaagcaattcaaacaactacaaaactaaagaaagtactgttggaataaacattct |
9132451 |
T |
|
| Q |
196 |
actgatatatgagtaaaagtagaacagataaaacaactttatcctagtagtaaacattacttttcctcactagaaagagcatagaagtttgatctgtagt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9132452 |
actgatatatgagtaaaagtagaacagattaaacaactttatcctagtagtaaacgttacttttcctcactagaaagagcatagaagtttgatctgtagt |
9132551 |
T |
|
| Q |
296 |
tagttggcagcttcagtgtctcatgcctcacgcctcaaa |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9132552 |
tagttggcagcttcagtgtctcatgcctcacgcctcaaa |
9132590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 103 - 202
Target Start/End: Original strand, 9126267 - 9126369
Alignment:
| Q |
103 |
ctgatagaggtactattgtctttgattttctggaaaacaaagcaattcaaacaactacaaaactaaagaaagtactgttggaat---gaacattctactg |
199 |
Q |
| |
|
|||||||||||||||| | | ||||| ||| |||||| | |||||| |||||| ||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
9126267 |
ctgatagaggtactatgttatatgattatctagaaaacgatgcaatttaaacaattacaaaactaaagaaagtactgttgtaataaccaacattctactg |
9126366 |
T |
|
| Q |
200 |
ata |
202 |
Q |
| |
|
||| |
|
|
| T |
9126367 |
ata |
9126369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University