View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12841_low_48 (Length: 253)
Name: NF12841_low_48
Description: NF12841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12841_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 20 - 245
Target Start/End: Original strand, 26801678 - 26801903
Alignment:
| Q |
20 |
attagttatattacatatgcttttaagcatacataataataactttcaatttatgtcttgagaacttgtagggtcaattaatctcttatatggctgccaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26801678 |
attagttatattacatatgcttttaagcatacataataataactttcaatttatgtcttgagaacttgtagggtcaattaatctcttatatggctgccaa |
26801777 |
T |
|
| Q |
120 |
taatgtgcattgcaagtgcctgtggcaagtgattaagtggtcatttgttaggccagctgcctgcataaatgaatgaaccactgttggaccaacatatcta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26801778 |
taatgtgcattgcaagtgcctgtggcaagtgattaagtggtcatttgttaggccagctgcctgcataaatgaatgaaccactgttggaccaacatatcta |
26801877 |
T |
|
| Q |
220 |
aaccctctcttaatcatgtctctgct |
245 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
26801878 |
aaccctctcttaatcatgtctttgct |
26801903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 117 - 245
Target Start/End: Original strand, 18415504 - 18415632
Alignment:
| Q |
117 |
caataatgtgcattgcaagtgcctgtggcaagtgattaagtggtcatttgttaggccagctgcctgcataaatgaatgaaccactgttggaccaacatat |
216 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||| || || |||||||| |||||||| ||||| |||||||| || || ||| | |
|
|
| T |
18415504 |
caataatgtgcatttcaagtggctgtggcaagtgattaagtggtcattggtgagaccagctgcttgcataaacgaatgtaccactgtggggcctacaaac |
18415603 |
T |
|
| Q |
217 |
ctaaaccctctcttaatcatgtctctgct |
245 |
Q |
| |
|
||||| ||||| | ||||||||| |||| |
|
|
| T |
18415604 |
ctaaaacctcttctgatcatgtctttgct |
18415632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University