View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12842_high_14 (Length: 284)
Name: NF12842_high_14
Description: NF12842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12842_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 264
Target Start/End: Original strand, 31876666 - 31876912
Alignment:
| Q |
18 |
ccatggtaatcttcatttgagatattggataattgtctttgtagttgctcatctaagcacatcatcttcttgttctcttgtctttgtacaattatgggag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31876666 |
ccatggtaatcttcatttgagatattggataattgtctttgtagttgctcatctaagcacatcatcttcttgttctcttgtctttgtacaattatgggag |
31876765 |
T |
|
| Q |
118 |
atggcttttggagaaagtttgaaggctttgtcatgtttatttggtggggttagctatatagcaaattgagggtgtgtatttatgttataatgtatatata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31876766 |
atggcttttggagaaagtttgaaggctttgtcatgtttatttggtggggttagctatttagcaaattgagggtgtgtatttatgttataatgtatatata |
31876865 |
T |
|
| Q |
218 |
agtagtagattagaatttgtgtgagacatgttcaaagggttttggta |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31876866 |
agtagtagattagaatttgtgtgagacatgttcaaagggttttggta |
31876912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University