View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12842_high_16 (Length: 255)

Name: NF12842_high_16
Description: NF12842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12842_high_16
NF12842_high_16
[»] chr1 (1 HSPs)
chr1 (17-253)||(45289394-45289630)
[»] chr3 (1 HSPs)
chr3 (34-202)||(39204468-39204638)


Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 45289630 - 45289394
Alignment:
17 agttatataaaccttacttcatgtatttgtttttaaattgcagatacaaacttggacaactttggtttcagttttgtgtttaattttctttattgtgaat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45289630 agttatataaaccttacttcatgtatttgtttttaaattgcagatacaaacttggacaactttggtttcagttttgtgtttaattttctttattgtgaat 45289531  T
117 gattcttattggaggaaatagttcgaaaggatctcctaggaggaggcatgttccttcatatgaatctccagggtctttatcttcatcggataacaattat 216  Q
    |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
45289530 gatttttgttggaggaaatagttcgaaaggatctcctaggaggaggcatgttccttcatatgaatctccaaggtctttatcttcatcggataacaattat 45289431  T
217 gaggtcatataaaacagagcccatatcaagcataatc 253  Q
    ||||||||| |||||||||||||||||||||||||||    
45289430 gaggtcataaaaaacagagcccatatcaagcataatc 45289394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 34 - 202
Target Start/End: Complemental strand, 39204638 - 39204468
Alignment:
34 ttcatgtatttgtttttaaattgcagatacaaacttggacaactttggtttcagttttgtgtttaattttctttattgtgaatga--ttcttattggagg 131  Q
    ||||||| |||||| |  |||||||| || ||||||||||| |||||||  || ||||||||||| |||  |||||| |||| ||  || |||| |||||    
39204638 ttcatgtctttgttatggaattgcagctagaaacttggacagctttggtagcaattttgtgtttactttattttattctgaaggagattgttatgggagg 39204539  T
132 aaatagttcgaaaggatctcctaggaggaggcatgttccttcatatgaatctccagggtctttatcttcat 202  Q
     |||||||| ||||| ||||||||||| ||||||||||||||||||||  || |||| |||| ||||||||    
39204538 gaatagttcaaaagggtctcctaggagaaggcatgttccttcatatgaggcttcaggttcttcatcttcat 39204468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University