View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12842_high_16 (Length: 255)
Name: NF12842_high_16
Description: NF12842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12842_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 45289630 - 45289394
Alignment:
| Q |
17 |
agttatataaaccttacttcatgtatttgtttttaaattgcagatacaaacttggacaactttggtttcagttttgtgtttaattttctttattgtgaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45289630 |
agttatataaaccttacttcatgtatttgtttttaaattgcagatacaaacttggacaactttggtttcagttttgtgtttaattttctttattgtgaat |
45289531 |
T |
 |
| Q |
117 |
gattcttattggaggaaatagttcgaaaggatctcctaggaggaggcatgttccttcatatgaatctccagggtctttatcttcatcggataacaattat |
216 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45289530 |
gatttttgttggaggaaatagttcgaaaggatctcctaggaggaggcatgttccttcatatgaatctccaaggtctttatcttcatcggataacaattat |
45289431 |
T |
 |
| Q |
217 |
gaggtcatataaaacagagcccatatcaagcataatc |
253 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45289430 |
gaggtcataaaaaacagagcccatatcaagcataatc |
45289394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 34 - 202
Target Start/End: Complemental strand, 39204638 - 39204468
Alignment:
| Q |
34 |
ttcatgtatttgtttttaaattgcagatacaaacttggacaactttggtttcagttttgtgtttaattttctttattgtgaatga--ttcttattggagg |
131 |
Q |
| |
|
||||||| |||||| | |||||||| || ||||||||||| ||||||| || ||||||||||| ||| |||||| |||| || || |||| ||||| |
|
|
| T |
39204638 |
ttcatgtctttgttatggaattgcagctagaaacttggacagctttggtagcaattttgtgtttactttattttattctgaaggagattgttatgggagg |
39204539 |
T |
 |
| Q |
132 |
aaatagttcgaaaggatctcctaggaggaggcatgttccttcatatgaatctccagggtctttatcttcat |
202 |
Q |
| |
|
|||||||| ||||| ||||||||||| |||||||||||||||||||| || |||| |||| |||||||| |
|
|
| T |
39204538 |
gaatagttcaaaagggtctcctaggagaaggcatgttccttcatatgaggcttcaggttcttcatcttcat |
39204468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University