View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12842_high_17 (Length: 244)
Name: NF12842_high_17
Description: NF12842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12842_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 22 - 228
Target Start/End: Original strand, 8097552 - 8097761
Alignment:
| Q |
22 |
aacttgatcaccaacaaaatcaatattattgtccttgttgccggnnnnnnnntaaaa---tgttgtgagccttccaaatcatctaaacgagagctaacca |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||| ||||| ||||||| |||||||||||||||| ||||||||| |
|
|
| T |
8097552 |
aacttgatcactaacaaaatcaatattattgtccttgttgccggaaaaagaaaaaaaaaatgttgcgagcctttcaaatcatctaaacgatagctaacca |
8097651 |
T |
 |
| Q |
119 |
aatgagttgaaaacacccccttggttttaaagcacgaacctatagatcacataattgttgaacatgggcagtagcttcgttagataatgcacaagagata |
218 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8097652 |
aatgagttgaaaacacccccttgatttcaaagcacgaacctatagctcacataattgttgaacatgggcagtagcttcgttagataatgcacaagagata |
8097751 |
T |
 |
| Q |
219 |
cccaactaat |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
8097752 |
cccaactaat |
8097761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University