View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12842_high_21 (Length: 218)
Name: NF12842_high_21
Description: NF12842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12842_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 51912259 - 51912074
Alignment:
| Q |
16 |
caattttgtgaagacaaagggctccaaattttttctcctttggagagaatatagtaatgtgctagcaacagaaacaagaaggattaaaacatgactttgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51912259 |
caattttgtgaagacaaagggctccaaattttttctcctttggagagaatatagtaatgtgctagcaacagaaacaagaaggattaaaacatgactttgt |
51912160 |
T |
 |
| Q |
116 |
acaacagcaacatggatttacctttggacaagttgggcaagagcaagtgcaggtgcatttgcaactgcataaagaagggcatgatg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51912159 |
acaacagcaacatggatttacctttggacaagttgggcaagagcaagtgcaggtgcatttgcaactgcataaagaagggcatgatg |
51912074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University