View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12842_low_24 (Length: 260)
Name: NF12842_low_24
Description: NF12842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12842_low_24 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 98 - 220
Target Start/End: Original strand, 24493177 - 24493299
Alignment:
| Q |
98 |
tgttttccttggttattctacacaatatcactcttacatttgtctagaccgagccactcgaagagtgcatttatctcgtcatgttgtttttgttgaagac |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24493177 |
tgttttccttggttattctacacaatatcactcttatatttgtctagaccgagccactcgaagagtgcatttatctcgtcatgttgtttttgttgaagac |
24493276 |
T |
 |
| Q |
198 |
cagtttcctttctcccatcaaaa |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
24493277 |
cagtttcctttctcccatcaaaa |
24493299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 98 - 220
Target Start/End: Original strand, 92542 - 92664
Alignment:
| Q |
98 |
tgttttccttggttattctacacaatatcactcttacatttgtctagaccgagccactcgaagagtgcatttatctcgtcatgttgtttttgttgaagac |
197 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
92542 |
tgttttacttggttattctacacaatatcactcttacatttgtctagatcgagccactcgaagagtgcatttatctcgtcatgttgtttttgttgaagac |
92641 |
T |
 |
| Q |
198 |
cagtttcctttctcccatcaaaa |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
92642 |
cagtttcctttctcccatcaaaa |
92664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University